Stem-loop sequence oan-mir-223

AccessionMI0006796 (change log)
DescriptionOrnithorhynchus anatinus miR-223 stem-loop
Gene family MIPF0000067; mir-223
Stem-loop
       c  --c    ccacacc   g    g    cc u                --g ug   -  u 
5' gcga ca   guga       gca ugcc cgcu  g guauuugacaagcuga   u  gac ac c
   |||| ||   ||||       ||| |||| ||||  | ||||||||||||||||   |  ||| || c
3' cguu gu   cacu       cgu acgg guga  c cauaaacuguuugacu   a  uug ug g
       u  acc    -------   -    a    au c                gug gu   g  u 
Get sequence
Deep sequencing
498 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig3675: 6073-6196 [+]
intergenic
Database links

Mature sequence oan-miR-223-5p

Accession MIMAT0007019
Previous IDsoan-miR-223*
Sequence

34 - 

cguguauuugacaagcugaguug

 - 56

Get sequence
Deep sequencing40 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-223-3p

Accession MIMAT0007020
Previous IDsoan-miR-223
Sequence

77 - 

ugucaguuugucaaauacccua

 - 98

Get sequence
Deep sequencing457 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).