Stem-loop sequence oan-mir-194-2

AccessionMI0006795 (change log)
DescriptionOrnithorhynchus anatinus miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
     g    --        cuu         a      g     --     
5' uu ugga  gcccaccc   guaacagca cuccau uggaa  gggu 
   || ||||  ||||||||   ||||||||| |||||| |||||  ||| c
3' ag gccu  uggguggg   uauugucgu gaggug accuu  uccu 
     g    ac        uuc         c      -     gg     
Get sequence
Deep sequencing
32392 reads, 480 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig35411: 246-337 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-194-2
oan-mir-194-2Contig35411: 246-337 [-]
oan-mir-192Contig35411: 1-91 [-]
Database links

Mature sequence oan-miR-194-5p

Accession MIMAT0006999
Previous IDsoan-miR-194
Sequence

18 - 

uguaacagcaacuccaugugga

 - 39

Get sequence
Deep sequencing64305 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-194-3p

Accession MIMAT0007018
Previous IDsoan-miR-194*
Sequence

54 - 

ccaguggagcugcuguuaucuu

 - 75

Get sequence
Deep sequencing190 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).