Stem-loop sequence oan-mir-146b

AccessionMI0006788 (change log)
DescriptionOrnithorhynchus anatinus miR-146b stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
        -caaa  c  --    u    c  a            aua   ugugagu 
5' aggcc     ug gg  ugcu ggcu ug gaacugaauucc   ggc       u
   |||||     || ||  |||| |||| || ||||||||||||   |||       g
3' uccgg     ac cc  acga ccga ac cuugacuuaggg   ccg       a
        ucacg  a  ca    c    c  -            auc   uaggagu 
Get sequence
Deep sequencing
303105 reads, 1.46e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig29185: 8147-8255 [+]
intergenic
Database links

Mature sequence oan-miR-146b-5p

Accession MIMAT0007007
Previous IDsoan-miR-146b
Sequence

25 - 

ugagaacugaauuccauaggcu

 - 46

Get sequence
Deep sequencing303044 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-146b-3p

Accession MIMAT0007008
Previous IDsoan-miR-146b*
Sequence

63 - 

gcccuagggauucaguuccaca

 - 84

Get sequence
Deep sequencing49 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).