Stem-loop sequence oan-mir-133b

AccessionMI0006780 (change log)
DescriptionOrnithorhynchus anatinus miR-133b stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
      c   -----a       c        ca  c  a      u  g   g 
5' cgg uga      cccugcu uggcuggu  aa gg accaag cc ucu c
   ||| |||      ||||||| ||||||||  || || |||||| || ||| c
3' gcc gcu      ggggcga aucgacca  uu cc ugguuu gg aga u
      u   acagcc       c        ac  c  c      -  -   g 
Get sequence
Deep sequencing
53787 reads, 940 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig26568: 7418-7515 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-133b
oan-mir-206Contig26568: 2813-2934 [+]
oan-mir-133bContig26568: 7418-7515 [+]
Database links

Mature sequence oan-miR-133b-5p

Accession MIMAT0006996
Previous IDsoan-miR-133b*
Sequence

19 - 

gcuggucaaacggaaccaaguc

 - 40

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-133b-3p

Accession MIMAT0006997
Previous IDsoan-miR-133b
Sequence

56 - 

uuugguccccuucaaccagcua

 - 77

Get sequence
Deep sequencing53785 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).