Stem-loop sequence oan-mir-206

AccessionMI0006779 (change log)
DescriptionOrnithorhynchus anatinus miR-206 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
      a     cccc   caa   cuc        a                cc     -   au 
5' agg ggccg    ggc   cug   uccgagac acaugcuucuuuauau  ccaua ugg  u
   ||| |||||    |||   |||   |||||||| ||||||||||||||||  ||||| |||   
3' ucc ccggc    ccg   gac   gggcuuug ugugugaaggaaugua  gguau guc  a
      g     ccuc   --a   --c        g                -a     c   gc 
Get sequence
Deep sequencing
308850 reads, 3.9e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig26568: 2813-2934 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-206
oan-mir-206Contig26568: 2813-2934 [+]
oan-mir-133bContig26568: 7418-7515 [+]
Database links

Mature sequence oan-miR-206-5p

Accession MIMAT0006994
Previous IDsoan-miR-206*
Sequence

35 - 

acaugcuucuuuauaucccca

 - 55

Get sequence
Deep sequencing12 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-206-3p

Accession MIMAT0006995
Previous IDsoan-miR-206
Sequence

73 - 

uggaauguaaggaagugugugg

 - 94

Get sequence
Deep sequencing308834 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).