Stem-loop sequence oan-mir-26-1

AccessionMI0006777 (change log)
DescriptionOrnithorhynchus anatinus miR-26 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
      uc  g     uu         c            c g 
5' ggc  cc cccgg  caaguaauc aggauaggcugu g c
   |||  || |||||  ||||||||| |||||||||||| |  
3' ccg  gg gggcu  guucauugg uccuguccggca c a
      gu  a     cu         c            - c 
Get sequence
Deep sequencing
290626 reads, 5.34e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig26164: 9817-9897 [-]
sense
ENSOANT00000003469 ; CTDSP2-201; intron 4
Database links

Mature sequence oan-miR-26-5p

Accession MIMAT0006991
Previous IDsoan-miR-26
Sequence

14 - 

uucaaguaauccaggauaggcu

 - 35

Get sequence
Deep sequencing579498 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-26-1-3p

Accession MIMAT0006992
Previous IDsoan-miR-26*
Sequence

49 - 

ccuguccucgguuacuugucuc

 - 70

Get sequence
Deep sequencing439 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).