Stem-loop sequence oan-mir-7-2

AccessionMI0006774 (change log)
DescriptionOrnithorhynchus anatinus miR-7-2 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   ----------gcugguccug       c     u  a     a u     u      cucua  u 
5'                     gccgggc ccguc gg agacu g gauuu guuguu     gc g
                       ||||||| ||||| || ||||| | ||||| ||||||     || a
3'                     uggcccg ggcag cc ucuga c cuaaa caacag     cg c
   cgugccgggggcugcuccug       u     u  g     c -     -      ---ca  c 
Get sequence
Deep sequencing
19697 reads, 280 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig242840: 301-418 [+]
intergenic
Database links

Mature sequence oan-miR-7-5p

Accession MIMAT0006986
Previous IDsoan-miR-7
Sequence

24 - 

uggaagacuagugauuuuguugu

 - 46

Get sequence
Deep sequencing51632 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-7-3p

Accession MIMAT0006987
Previous IDsoan-miR-7*
Sequence

66 - 

caacaaaucccagucugccuga

 - 87

Get sequence
Deep sequencing4952 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).