Stem-loop sequence oan-mir-1421j

AccessionMI0006771 (change log)
DescriptionOrnithorhynchus anatinus miR-1421j stem-loop
Gene family MIPF0000564; mir-1421
Stem-loop
   u     c  -accu  --c    g     a uua        a    a      aga 
5'  uccgg cg     ac   gcac gugug g   gucacgug ggug agugug   g
    ||||| ||     ||   |||| ||||| |   |||||||| |||| ||||||   u
3'  agguc gc     ug   cgug cacau c   caguguac cuac ucacac   g
   g     u  cccuc  uaa    a     c cuc        a    g      aag 
Get sequence
Deep sequencing
119 reads, 25 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig22847: 9647-9760 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-1421j
oan-mir-1421jContig22847: 9647-9760 [-]
oan-mir-1421i-1Contig22847: 9450-9510 [-]
oan-mir-1421hContig22847: 6874-6963 [-]
oan-mir-1421g-1Contig22847: 6129-6240 [-]
oan-mir-1419gContig22847: 5741-5822 [-]
oan-mir-1421fContig22847: 5019-5107 [-]
oan-mir-1421eContig22847: 3936-4040 [-]
oan-mir-1421dContig22847: 3447-3563 [-]
oan-mir-1421cContig22847: 2828-2908 [-]
oan-mir-1419fContig22847: 2420-2526 [-]
oan-mir-1421bContig22847: 1681-1759 [-]
oan-mir-1421aContig22847: 75-167 [-]
Database links

Mature sequence oan-miR-1421j-5p

Accession MIMAT0006981
Sequence

30 - 

uagucacgugaggugaagugug

 - 51

Get sequence
Deep sequencing86 reads, 4 experiments
Evidence experimental; Illumina [1-2]

Mature sequence oan-miR-1421j-3p

Accession MIMAT0026757
Sequence

62 - 

acacugcaucacaugugaccucc

 - 84

Get sequence
Deep sequencing31 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).