Stem-loop sequence oan-mir-1351

AccessionMI0006749 (change log)
DescriptionOrnithorhynchus anatinus miR-1351 stem-loop
Stem-loop
   gggccaaaccgcggu     -ugcu      ga          ugu      ---    u 
5'                ccucc     gggccc  gccccagcca   ccgagu   cucg g
                  |||||     ||||||  ||||||||||   ||||||   |||| u
3'                ggagg     ccuggg  cggggucggu   gguucg   gagc a
   ---------cccggu     uuucc      --          uuc      guu    u 
Get sequence
Deep sequencing
147 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig19877: 5135-5242 [+]
sense
Clustered miRNAs
< 10kb from oan-mir-1351
oan-mir-103-2Contig19877: 3174-3278 [+]
oan-mir-1351Contig19877: 5135-5242 [+]
Database links

Mature sequence oan-miR-1351-5p

Accession MIMAT0006943
Sequence

29 - 

ccgagccccagccauguccgagu

 - 51

Get sequence
Deep sequencing122 reads, 4 experiments
Evidence experimental; Illumina [1-2]

Mature sequence oan-miR-1351-3p

Accession MIMAT0026756
Sequence

70 - 

uuggcuuuggcuggggcgggu

 - 90

Get sequence
Deep sequencing23 reads, 3 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).