Stem-loop sequence oan-mir-1420e

AccessionMI0006739 (change log)
DescriptionOrnithorhynchus anatinus miR-1420e stem-loop
Gene family MIPF0000574; mir-1420
Stem-loop
   cugaac    ucu   -         gu u      c    c      c    gaca 
5'       ucgu   ucg cccagcuau  c gucuga ccag uguacu ucug    u
         ||||   ||| |||||||||  | |||||| |||| |||||| ||||    a
3'       ggca   agu ggguuggua  g uaggcu gguc gcguga agac    a
   -gguac    -cu   a         ug c      a    a      a    gaaa 
Get sequence
Deep sequencing
79 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig1754: 88652-88765 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-1420e
oan-mir-1420aContig1754: 86316-86413 [+]
oan-mir-1420bContig1754: 86458-86567 [+]
oan-mir-1420cContig1754: 87021-87126 [+]
oan-mir-1420dContig1754: 88499-88614 [+]
oan-mir-1420eContig1754: 88652-88765 [+]
oan-mir-1347Contig1754: 88992-89119 [+]
Database links

Mature sequence oan-miR-1420e-5p

Accession MIMAT0026755
Sequence

30 - 

gucugacccagcuguacucucu

 - 51

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence oan-miR-1420e-3p

Accession MIMAT0006929
Sequence

67 - 

aaagugcgacuggaucggaucg

 - 88

Get sequence
Deep sequencing77 reads, 5 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).