Stem-loop sequence oan-mir-1420c

AccessionMI0006737 (change log)
DescriptionOrnithorhynchus anatinus miR-1420c stem-loop
Gene family MIPF0000574; mir-1420
Stem-loop
   ugcucacu    ug     -   u  c       u   cuu     g   gg     
5'         ucac  cucaa ccu gc uauccga cgg   gcacu ucu  uuau 
           ||||  ||||| ||| || ||||||| |||   ||||| |||  ||| a
3'         agug  gaguu gga ug guaggcu gcc   cguga agg  aauu 
   ------ac    ug     u   u  a       u   cuu     a   ga     
Get sequence
Deep sequencing
244 reads, 50 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig1754: 87021-87126 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-1420c
oan-mir-1420aContig1754: 86316-86413 [+]
oan-mir-1420bContig1754: 86458-86567 [+]
oan-mir-1420cContig1754: 87021-87126 [+]
oan-mir-1420dContig1754: 88499-88614 [+]
oan-mir-1420eContig1754: 88652-88765 [+]
oan-mir-1347Contig1754: 88992-89119 [+]
Database links

Mature sequence oan-miR-1420c-5p

Accession MIMAT0026754
Sequence

28 - 

auccgaucggcuugcacugucu

 - 49

Get sequence
Deep sequencing24 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence oan-miR-1420c-3p

Accession MIMAT0006926
Sequence

65 - 

aaagugcuucccguucggauga

 - 86

Get sequence
Deep sequencing220 reads, 4 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).