Stem-loop sequence oan-mir-1420a

AccessionMI0006735 (change log)
DescriptionOrnithorhynchus anatinus miR-1420a stem-loop
Gene family MIPF0000574; mir-1420
Stem-loop
   ---   ucauu     u   u  ca      u   ccu     c   gg     
5'    gca     cccca cuu gu  auucga cag   gcacu ucu  uugu 
      |||     ||||| ||| ||  |||||| |||   ||||| |||  ||| g
3'    cgu     ggggu gga ca  uaggcu guc   cguga agg  gacu 
   cgg   -----     c   -  aa      u   cuu     a   aa     
Get sequence
Deep sequencing
203 reads, 50 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig1754: 86316-86413 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-1420a
oan-mir-1420aContig1754: 86316-86413 [+]
oan-mir-1420bContig1754: 86458-86567 [+]
oan-mir-1420cContig1754: 87021-87126 [+]
oan-mir-1420dContig1754: 88499-88614 [+]
oan-mir-1420eContig1754: 88652-88765 [+]
oan-mir-1347Contig1754: 88992-89119 [+]
Database links

Mature sequence oan-miR-1420a-5p

Accession MIMAT0006922
Previous IDsoan-miR-1420a*
Sequence

23 - 

auucgaucagccugcacucu

 - 42

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-1420a-3p

Accession MIMAT0006923
Previous IDsoan-miR-1420a
Sequence

60 - 

aaagugcuuccuguucggauaa

 - 81

Get sequence
Deep sequencing195 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).