Stem-loop sequence oan-mir-137b

AccessionMI0006710 (change log)
DescriptionOrnithorhynchus anatinus miR-137b stem-loop
Gene family MIPF0000106; mir-137
Stem-loop
   ---------cca   - -        g   g       ug    c      -  g 
5'             gcc c cuuucgau acg guauucu  ggua auaaua cg a
               ||| | |||||||| ||| |||||||  |||| |||||| || u
3'             cgg g gggagcug ugc cauaaga  ucgu uauugu gc g
   ggucugcagcca   a a        a   g       gu    -      c  g 
Get sequence
Deep sequencing
37572 reads, 800 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig10993: 7498-7597 [-]
intergenic
Database links

Mature sequence oan-miR-137b-5p

Accession MIMAT0026753
Sequence

17 - 

acggguauucuuggguacauaaua

 - 40

Get sequence
Deep sequencing92 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence oan-miR-137b-3p

Accession MIMAT0006878
Sequence

53 - 

uuauugcuugagaauacgcguag

 - 75

Get sequence
Deep sequencing37480 reads, 4 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).