Stem-loop sequence oan-mir-135b-1

AccessionMI0006705 (change log)
DescriptionOrnithorhynchus anatinus miR-135b-1 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
      -a  -     uuggcu    g                  uau          uug ug 
5' cgg  uc cuccc      cucu cuguggccuauggcuuuu   uccuauguga   c  c
   |||  || |||||      |||| ||||||||||||||||||   ||||||||||   |   
3' gcc  ag gaggg      gaga gacaucggguaccgaaag   gggauguacu   g  u
      ac  a     ------    -                  -uc          caa uu 
Get sequence
Deep sequencing
30666 reads, 320 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig10074: 3245-3358 [-]
intergenic
Database links

Mature sequence oan-miR-135b-5p

Accession MIMAT0006870
Previous IDsoan-miR-135b
Sequence

31 - 

uauggcuuuuuauuccuauguga

 - 53

Get sequence
Deep sequencing34513 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-135b-1-3p

Accession MIMAT0006871
Previous IDsoan-miR-135b*
Sequence

70 - 

auguagggcugaaagccauggg

 - 91

Get sequence
Deep sequencing13331 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).