Stem-loop sequence oan-mir-205

AccessionMI0006703 (change log)
DescriptionOrnithorhynchus anatinus miR-205 stem-loop
Gene family MIPF0000058; mir-205
Stem-loop
   ga      aacga      gguu   g    c           c        uuucg 
5'   auucgg     uccaug    ucu uugu cuucauuccac ggagucug     u
     ||||||     ||||||    ||| |||| ||||||||||| ||||||||     a
3'   uaaguu     agguac    gga aaca gaagugaggug cuuuagac     c
   -c      ----g      ----   g    c           a        uaauc 
Get sequence
Deep sequencing
34 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
7: 39687501-39687608 [+]
intergenic
Database links

Mature sequence oan-miR-205-5p

Accession MIMAT0006866
Previous IDsoan-miR-205
Sequence

31 - 

uccuucauuccaccggagucu

 - 51

Get sequence
Deep sequencing34 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-205-3p

Accession MIMAT0006867
Previous IDsoan-miR-205*
Sequence

68 - 

gauuucaguggagugaagcaca

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).