Stem-loop sequence oan-mir-1a

AccessionMI0006700 (change log)
DescriptionOrnithorhynchus anatinus miR-1a stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
      a  ua a      c                     ac     ugaaca 
5' ggg ug  c ccugcu agaguacauacuucuuuaugu  ccaua      u
   ||| ||  | |||||| |||||||||||||||||||||  |||||       
3' ccc gc  g ggacgg uuuuauguaugaagaaaugua  gguau      a
      a  -c c      u                     -a     cgaaaa 
Get sequence
Deep sequencing
6557971 reads, 1.2e+05 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
7: 18283571-18283672 [+]
antisense
Clustered miRNAs
< 10kb from oan-mir-1a
oan-mir-1a7: 18283571-18283672 [+]
oan-mir-133a-17: 18287487-18287587 [+]
Database links

Mature sequence oan-miR-1a-5p

Accession MIMAT0026752
Sequence

23 - 

acauacuucuuuauguacccaua

 - 45

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence oan-miR-1a-3p

Accession MIMAT0006863
Sequence

62 - 

uggaauguaaagaaguauguau

 - 83

Get sequence
Deep sequencing6557957 reads, 5 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).