Stem-loop sequence oan-mir-15c

AccessionMI0006691 (change log)
DescriptionOrnithorhynchus anatinus miR-15c stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
        ----caga  ---ag     a        ua     a  uc          gggac 
5' gccca        gc     ccuug ggggguug  gcagc ca  augguuugua     a
   |||||        ||     ||||| ||||||||  ||||| ||  ||||||||||      
3' cgggu        cg     ggaac ccccuaac  cgucg gu  uaccagacau     a
        caagaggg  caaga     -        uc     g  cu          agagg 
Get sequence
Deep sequencing
10492 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
6: 8405715-8405830 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-15c
oan-mir-15c6: 8405715-8405830 [+]
oan-mir-16c6: 8406045-8406164 [+]
Database links

Mature sequence oan-miR-15c-5p

Accession MIMAT0006845
Previous IDsoan-miR-15c
Sequence

28 - 

uagcagcacaucaugguuugu

 - 48

Get sequence
Deep sequencing10467 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-15c-3p

Accession MIMAT0006846
Previous IDsoan-miR-15c*
Sequence

64 - 

cagaccauucugggcugccuca

 - 85

Get sequence
Deep sequencing25 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).