Stem-loop sequence oan-mir-181b-1

AccessionMI0006686 (change log)
DescriptionOrnithorhynchus anatinus miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   ugca a   uaa a     --c   -augaa         cug           aa  c 
5'     g guu   c aaggu   cca      cauucauug   ucgguggguuu  cu u
       | |||   | |||||   |||      |||||||||   |||||||||||  ||  
3'     c caa   g uucca   ggu      guaaguaac   agucacucgaa  gg g
   ---a -   -cg a     cuc   gucaag         --a           ca  a 
Get sequence
Deep sequencing
341146 reads, 5.12e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
4: 46540360-46540469 [+]
sense
ENSOANT00000029370 ; oan-mir-181a-1-201; 3'UTR (exon 5)
Clustered miRNAs
< 10kb from oan-mir-181b-1
oan-mir-181a-14: 46540174-46540300 [+]
oan-mir-181b-14: 46540360-46540469 [+]
Database links

Mature sequence oan-miR-181b-5p

Accession MIMAT0006835
Previous IDsoan-miR-181b
Sequence

27 - 

aacauucauugcugucggugg

 - 47

Get sequence
Deep sequencing677477 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-181b-1-3p

Accession MIMAT0006836
Previous IDsoan-miR-181b*
Sequence

67 - 

cucacugaacaaugaauggaa

 - 87

Get sequence
Deep sequencing2400 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).