Stem-loop sequence oan-mir-181a-1

AccessionMI0006685 (change log)
DescriptionOrnithorhynchus anatinus miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   -----------   uucugcuu  aa        u   u a   u      cu       a    ggaau 
5'            gaa        cg  ugguugcu cag g aca ucaacg  gucggug guuu     u
              |||        ||  |||||||| ||| | ||| ||||||  ||||||| ||||     a
3'            cuu        gc  accaacgg guc c ugu aguugc  cagcuac caaa     a
   cuuucguacuu   -uccuccu  -c        c   c a   u      --       -    gauga 
Get sequence
Deep sequencing
1776297 reads, 2.72e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
4: 46540174-46540300 [+]
sense
ENSOANT00000029370 ; oan-mir-181a-1-201; 3'UTR (exon 5)
Clustered miRNAs
< 10kb from oan-mir-181a-1
oan-mir-181a-14: 46540174-46540300 [+]
oan-mir-181b-14: 46540360-46540469 [+]
Database links

Mature sequence oan-miR-181a-5p

Accession MIMAT0006833
Previous IDsoan-miR-181a
Sequence

30 - 

aacauucaacgcugucggugagu

 - 52

Get sequence
Deep sequencing5153740 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-181a-1-3p

Accession MIMAT0006834
Previous IDsoan-miR-181a*
Sequence

70 - 

accaucgaccguugauuguacc

 - 91

Get sequence
Deep sequencing57622 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).