Stem-loop sequence oan-mir-1332

AccessionMI0006675 (change log)
DescriptionOrnithorhynchus anatinus miR-1332 stem-loop
Stem-loop
      --ga   a             uc       c  -  a 
5' ccc    cca ucagaggccaucu  aaccgau gg ga c
   |||    ||| |||||||||||||  ||||||| || ||  
3' ggg    ggu agucucuggugga  uugguua cc cu a
      aacc   c             ga       a  u  g 
Get sequence
Deep sequencing
854 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
2: 28891525-28891603 [+]
intergenic
Database links

Mature sequence oan-miR-1332-5p

Accession MIMAT0026751
Sequence

13 - 

gaggccaucuucaaccgaucgg

 - 34

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence oan-miR-1332-3p

Accession MIMAT0006819
Sequence

46 - 

aauugguuagagguggucucug

 - 67

Get sequence
Deep sequencing842 reads, 5 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).