Stem-loop sequence oan-mir-29b-1

AccessionMI0006669 (change log)
Previous IDsoan-mir-29b
DescriptionOrnithorhynchus anatinus miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
      -    a  acgauuuuaaag    u       -          u      gu      uua   a 
5' gag guag cc            cucc ucaggaa gcugguuuca auggug  uuagau   acu c
   ||| |||| ||            |||| ||||||| |||||||||| ||||||  ||||||   |||  
3' uuc cguc gg            gagg gguucuu ugacuaaagu uaccac  gaucug   uga u
      a    -  ---------caa    u       g          u      --      ---   g 
Get sequence
Deep sequencing
27691 reads, 300 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
10: 5175427-5175547 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-29b-1
oan-mir-29b-110: 5175427-5175547 [-]
oan-mir-29a-110: 5175036-5175153 [-]
Database links

Mature sequence oan-miR-29b-5p

Accession MIMAT0006808
Previous IDsoan-miR-29b*
Sequence

36 - 

cugguuucauauggugguuuag

 - 57

Get sequence
Deep sequencing1359 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-29b-3p

Accession MIMAT0006809
Previous IDsoan-miR-29b
Sequence

76 - 

uagcaccauuugaaaucagugu

 - 97

Get sequence
Deep sequencing52661 reads, 5 experiments
Evidence not experimental
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).