Stem-loop sequence oan-mir-29a-1

AccessionMI0006668 (change log)
DescriptionOrnithorhynchus anatinus miR-29a-1 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
      -aa   uc    ga    ucuagagg            uuu       c    ucaa 
5' uca   ggc  cugu  cccc        augacugauuuc   ugguguu agag    u
   |||   |||  ||||  ||||        ||||||||||||   ||||||| ||||    a
3' agu   ccg  gaua  gggg        uauuggcuaaag   accacga ucuu    u
      gca   -c    -a    -uuaguaa            uuu       -    uuac 
Get sequence
Deep sequencing
28893 reads, 340 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
10: 5175036-5175153 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-29a-1
oan-mir-29b-110: 5175427-5175547 [-]
oan-mir-29a-110: 5175036-5175153 [-]
Database links

Mature sequence oan-miR-29a-1-5p

Accession MIMAT0006806
Previous IDsoan-miR-29a-1*
Sequence

32 - 

acugauuucuuuugguguucag

 - 53

Get sequence
Deep sequencing780 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-29a-3p

Accession MIMAT0006807
Previous IDsoan-miR-29a
Sequence

70 - 

uagcaccauuugaaaucgguu

 - 90

Get sequence
Deep sequencing56189 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).