Stem-loop sequence oan-mir-96

AccessionMI0006666 (change log)
DescriptionOrnithorhynchus anatinus miR-96 stem-loop
Gene family MIPF0000072; mir-96
Stem-loop
   gugga   --g   -    gg   cuu         g     uu      -uu  cu 
5'      gau   ucu gcuu  ccu   uuggcacua cacau  uugcuu   gu  c
        |||   ||| ||||  |||   ||||||||| |||||  ||||||   ||   
3'      cug   agg cgaa  ggg   aaccgugau gugua  aacgag   cg  u
   --cga   uua   u    aa   uau         -     cu      ucu  uc 
Get sequence
Deep sequencing
52 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
10: 4568763-4568871 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-96
oan-mir-18310: 4569067-4569197 [-]
oan-mir-9610: 4568763-4568871 [-]
oan-mir-18210: 4559452-4559551 [-]
Database links

Mature sequence oan-miR-96-5p

Accession MIMAT0006803
Previous IDsoan-miR-96
Sequence

24 - 

uuuggcacuagcacauuuuugcu

 - 46

Get sequence
Deep sequencing50 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-96-3p

Accession MIMAT0006804
Previous IDsoan-miR-96*
Sequence

66 - 

caaucauguguagugccaauau

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).