Stem-loop sequence oan-mir-1327

AccessionMI0006661 (change log)
DescriptionOrnithorhynchus anatinus miR-1327 stem-loop
Stem-loop
   -uuaacaa  acu   c    -------                 cug          auccuauauu 
5'         gg   gua uggg       gacuguucuuuaaaagg   uuaaaugaug          u
           ||   ||| ||||       |||||||||||||||||   ||||||||||           
3'         cc   cau accc       cuggcaagagauuuucc   gauuuacuac          u
   aaaaacgg  -ac   c    acuccuu                 aaa          aacugcaauu 
Get sequence
Deep sequencing
3103 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
1: 16822264-16822392 [-]
sense
ENSOANT00000004915 ; AP3B1-201; intron 20
Database links

Mature sequence oan-miR-1327-5p

Accession MIMAT0006796
Sequence

31 - 

uaaaaggcuguuaaaugaugau

 - 52

Get sequence
Deep sequencing3096 reads, 5 experiments
Evidence experimental; Illumina [1-2]

Mature sequence oan-miR-1327-3p

Accession MIMAT0026750
Sequence

73 - 

caucauuuagaaaccuuuuaga

 - 94

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).