Stem-loop sequence hsa-mir-1324

AccessionMI0006657 (change log)
Symbol HGNC:MIR1324
DescriptionHomo sapiens miR-1324 stem-loop
Gene family MIPF0000589; mir-1324
Literature search

5 open access papers mention hsa-mir-1324
(6 sentences)

Stem-loop
   -----   ga  --        -   gc   -gucc     ucacu     c 
5'      ccu  ag  aggugcau gaa  cug     ugccc     gggaa c
        |||  ||  |||||||| |||  |||     |||||     ||||| c
3'      gga  uc  uucacgua cuu  gac     auggg     cccuu c
   accuc   gg  cu        u   aa   agacc     --ucu     c 
Get sequence
Deep sequencing
48 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Afanasyeva et al. refer to this sequence using the internal identifier MYCNSC_NB8_202 [1]. Some additional sequences reported in [1] do not meet miRBase requirements for miRNA identification.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 75630763-75630858 [+]
intergenic
Database links

Mature sequence hsa-miR-1324

Accession MIMAT0005956
Sequence

61 - 

ccagacagaauucuaugcacuuuc

 - 84

Get sequence
Deep sequencing31 reads, 17 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).