|
miRBase |
|
Stem-loop sequence hsa-mir-1197 |
|||||
| Accession | MI0006656 | ||||
| Symbol | HGNC:MIR1197 | ||||
| Description | Homo sapiens miR-1197 stem-loop | ||||
| Gene family | MIPF0000126; mir-379 | ||||
| Stem-loop |
acuuccu -u ugc u gug g - uuu
gguauu gaaga ggu gaccaug u uacg c a
|||||| ||||| ||| ||||||| | |||| | u
cuauaa cuucu uca cugguac g augc g u
------a cu --- u aca g a ugu
|
||||
| Deep sequencing |
| ||||
| Comments |
Afanasyeva et al. refer to this sequence using the internal identifier MYCNSC_NB5_330 [1]. Some additional sequences reported in [1] do not meet miRBase requirements for miRNA identification. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-1197 |
|
| Accession | MIMAT0005955 |
| Sequence |
57 - uaggacacauggucuacuucu - 77 |
| Deep sequencing | 44 reads, 1 experiments |
| Evidence | experimental; cloned [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18230126
"New miRNAs cloned from neuroblastoma"
BMC Genomics. 9:52(2008).
|