Dead miRNA entry

miRNA accession:
MI0006654
miRNA ID:
hsa-mir-720
Comment:
Schopman et al. show that the sequence annotated as miR-720 is likely to be a fragment of a tRNA, and so is removed from the database (RNA Biol. 2010 7:573-576).

Previous miRNA entry

Stem-loop sequence hsa-mir-720

AccessionMI0006654 (change log)
Symbol HGNC:MIR720~withdrawn
DescriptionHomo sapiens miR-720 stem-loop
Stem-loop
   -----------------ccgg      cacg       ------         gcug    - uc a 
5'                      aucuca    guggugu      uaauaucuc    gggc c  c a
                        ||||||    |||||||      |||||||||    |||| |  | a
3'                      uagagu    caccaca      auugugggg    cccg g  g a
   gauuauuuccugagaauuaag      uuca       aaagag         ---a    u uu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links