Stem-loop sequence hsa-mir-513b

AccessionMI0006648
Symbol HGNC:MIR513B
DescriptionHomo sapiens miR-513b stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   --g      g   cu   a          u         gaa 
5'    uguaca ugc  uuc caaggaggug cauuuaugu   c
      |||||| |||  ||| |||||||||| |||||||||    
3'    acaugu aug  gag guuuuuccac guaaauaua   u
   acg      a   ag   a          u         aaa 
Get sequence
Deep sequencing
1476 reads, 314 reads per million, 30 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 147199044-147199127 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-513b
hsa-mir-513bchrX: 147199044-147199127 [-]
hsa-mir-513cchrX: 147189704-147189787 [-]
Database links

Mature sequence hsa-miR-513b-5p

Accession MIMAT0005788
Sequence

14 - 

uucacaaggaggugucauuuau

 - 35

Get sequence
Deep sequencing321 reads, 19 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-513b-3p

Accession MIMAT0026749
Sequence

50 - 

aaaugucaccuuuuugagagga

 - 71

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).