Stem-loop sequence mml-mir-514a

AccessionMI0006621 (change log)
Previous IDsmml-mir-514;mml-mir-514-1;mml-mir-514
DescriptionMacaca mulatta miR-514 stem-loop
Gene family MIPF0000130; mir-506
Literature search

1 open access papers mention mml-mir-514a
(1 sentences)

Stem-loop
       u   -   gg   c      -    g    a      u  aua 
5' augu guc ugu  uac cuacuc ugga agug caauca gu   a
   |||| ||| |||  ||| |||||| |||| |||| |||||| ||    
3' ugca cag acg  aug gaugag gucu ucac guuagu ua   u
       -   u   ua   a      u    -    a      u  aau 
Get sequence
Deep sequencing
99166 reads, 4.51e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 140981169-140981260 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-514a
mml-mir-514achrX: 140981169-140981260 [-]
mml-mir-510chrX: 140974535-140974632 [-]
Database links

Mature sequence mml-miR-514a-5p

Accession MIMAT0026748
Sequence

19 - 

uacucuggagagugacaauca

 - 39

Get sequence
Deep sequencing404 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-514a-3p

Accession MIMAT0005769
Previous IDsmml-miR-514
Sequence

56 - 

auugacacuucugugaguaga

 - 76

Get sequence
Deep sequencing98762 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).