Stem-loop sequence mml-mir-513a-2

AccessionMI0006619 (change log)
DescriptionMacaca mulatta miR-513a-2 stem-loop
Gene family MIPF0000130; mir-506
Literature search

2 open access papers mention mml-mir-513a-2
(57 sentences)

Stem-loop
   u     g   c    a   gg     uc        gaa 
5'  guaca ugc uuuc cag  aggug  auuuaugu   c
    ||||| ||| |||| |||  |||||  ||||||||    
3'  caugu aug gaag guc  uccac  uaaauaua   u
   a     a   a    a   uu     uu        aaa 
Get sequence
Deep sequencing
1935 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 140933333-140933412 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-513a-2
mml-mir-513a-3chrX: 140941885-140941966 [-]
mml-mir-513a-2chrX: 140933333-140933412 [-]
mml-mir-513a-1chrX: 140924359-140924440 [-]
Database links

Mature sequence mml-miR-513a

Accession MIMAT0005768
Sequence

13 - 

uucacagggaggugucauuuau

 - 34

Get sequence
Deep sequencing2976 reads, 8 experiments
Evidence by similarity; MI0003191
Predicted targets

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).