Stem-loop sequence mml-mir-510

AccessionMI0006615 (change log)
DescriptionMacaca mulatta miR-510 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   ugc  ug   -     g  uc      -c    a  gg         aua 
5'    ug  ugu gugug ua  cuacuc  ggag gu  caaucacau   a
      ||  ||| ||||| ||  ||||||  |||| ||  |||||||||    
3'    au  aca uacac au  ggugag  ucuc ca  guuagugug   u
   -uc  gu   g     a  ga      aa    -  aa         aau 
Get sequence
Deep sequencing
8430 reads, 267 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 140974535-140974632 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-510
mml-mir-514achrX: 140981169-140981260 [-]
mml-mir-510chrX: 140974535-140974632 [-]
mml-mir-509-2chrX: 140966410-140966503 [-]
Database links

Mature sequence mml-miR-510-5p

Accession MIMAT0005766
Sequence

22 - 

uacuccggagaguggcaaucaca

 - 44

Get sequence
Deep sequencing1265 reads, 8 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-510-3p

Accession MIMAT0026747
Sequence

57 - 

ugauugaaaccucuaagagugga

 - 79

Get sequence
Deep sequencing7163 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).