Stem-loop sequence mml-mir-508

AccessionMI0006612 (change log)
DescriptionMacaca mulatta miR-508 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   u  -    cg          c        u  c   cauaaa 
5'  ga gugu  ugcucuacuc agagggcg ca uca      c
    || ||||  |||||||||| |||||||| || |||       
3'  cu caca  augagaugag uuuuccgc gu agu      u
   a  a    ua          u        u  u   acaaaa 
Get sequence
Deep sequencing
124881 reads, 6.78e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 140953010-140953094 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-508
mml-mir-514bchrX: 140957046-140957156 [-]
mml-mir-508chrX: 140953010-140953094 [-]
mml-mir-507chrX: 140947139-140947232 [-]
mml-mir-506chrX: 140946806-140946914 [-]
Database links

Mature sequence mml-miR-508-5p

Accession MIMAT0026746
Sequence

15 - 

uacuccagagggcgucacuca

 - 35

Get sequence
Deep sequencing75 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-508-3p

Accession MIMAT0005764
Sequence

50 - 

ugauugucgccuuuuugaguaga

 - 72

Get sequence
Deep sequencing124806 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).