Stem-loop sequence mml-mir-506

AccessionMI0006610 (change log)
DescriptionMacaca mulatta miR-506 stem-loop
Gene family MIPF0000130; mir-506
Literature search

1 open access papers mention mml-mir-506
(1 sentences)

Stem-loop
   ------      --g   -      guguagugcc          a     --   uu     a 
5'       ugucua   ugc cguuau          uuauucagga ggugu  uac  aauau u
         ||||||   ||| ||||||          |||||||||| |||||  |||  |||||  
3'       acaggu   acg guaaug          gaugagucuu ccacg  aug  uuaua u
   uuuacu      aca   u      ---------a          c     ga   -u     a 
Get sequence
Deep sequencing
25893 reads, 1.04e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 140946806-140946914 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-506
mml-mir-508chrX: 140953010-140953094 [-]
mml-mir-507chrX: 140947139-140947232 [-]
mml-mir-506chrX: 140946806-140946914 [-]
mml-mir-513a-3chrX: 140941885-140941966 [-]
Database links

Mature sequence mml-miR-506-5p

Accession MIMAT0026745
Sequence

28 - 

uauucaggaagguguuacuu

 - 47

Get sequence
Deep sequencing143 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-506-3p

Accession MIMAT0005762
Sequence

64 - 

uaaggcacccuucugaguaga

 - 84

Get sequence
Deep sequencing25745 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).