Stem-loop sequence vvi-MIR535b

AccessionMI0006581 (change log)
DescriptionVitis vinifera miR535b stem-loop
Gene family MIPF0000136; MIR535
Stem-loop
   --ugua    cu     a                a  ca   u     cg 
5'       auug  ugaca cgagagagagcacgcu gu  gca ucaug  a
         ||||  ||||| |||||||||||||||| ||  ||| |||||  g
3'       uaac  acugu gcucucucucgugcgg ca  ugu aguac  g
   cucuuc    au     c                a  ug   c     aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
NW_003724313.1: 7083-7183 [-]
intergenic
Database links

Mature sequence vvi-miR535b

Accession MIMAT0005736
Sequence

11 - 

ugacaacgagagagagcacgc

 - 31

Get sequence
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).