Stem-loop sequence vvi-MIR399e

AccessionMI0006575 (change log)
DescriptionVitis vinifera miR399e stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention vvi-MIR399e
(11 sentences)

Stem-loop
   --gcauauuaca         a            ca  -    ua    caca  caa 
5'             gggcaaauu ucuuuuggcagg  gc cacu  gaga    gc   g
               ||||||||| ||||||||||||  || ||||  ||||    ||    
3'             cccguuuag aggaaaccgucu  cg guga  uucu    cg   c
   ucuucuuaacgg         -            cc  u    ug    --ua  uac 
Get sequence
Deep sequencing
131 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr10: 2992220-2992331 [-]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR399e
vvi-MIR399fchr10: 2995807-2995913 [-]
vvi-MIR399echr10: 2992220-2992331 [-]
vvi-MIR399achr10: 2989450-2989546 [+]
vvi-MIR399dchr10: 2988021-2988125 [-]
vvi-MIR399hchr10: 2983545-2983634 [+]
Database links

Mature sequence vvi-miR399e

Accession MIMAT0005730
Sequence

82 - 

ugccaaaggagauuugcccgg

 - 102

Get sequence
Deep sequencing131 reads, 2 experiments
Evidence by similarity; MI0002347

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).