Stem-loop sequence vvi-MIR399b

AccessionMI0006574 (change log)
DescriptionVitis vinifera miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

5 open access papers mention vvi-MIR399b
(12 sentences)

Stem-loop
   --au  a          c     uc        -   ---------ug  uc   -ua    aa 
5'     ca ucauagggca cucuu  uuggcagg cac           gc  cua   uaug  u
       || |||||||||| |||||  |||||||| |||           ||  |||   ||||   
3'     gu agugucccgu gagag  aaccguuc gug           cg  gau   auac  a
   cuuc  c          u     ga        a   uagaaaaauga  uc   ucg    au 
Get sequence
Deep sequencing
346 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr16: 15618708-15618824 [-]
intergenic
Database links

Mature sequence vvi-miR399b

Accession MIMAT0005729
Sequence

87 - 

ugccaaaggagaguugcccug

 - 107

Get sequence
Deep sequencing312 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).