Stem-loop sequence vvi-MIR399a

AccessionMI0006573 (change log)
DescriptionVitis vinifera miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

5 open access papers mention vvi-MIR399a
(12 sentences)

Stem-loop
   --ga         u ug                 -auauca   augga 
5'     gaauaacag g  auucuccuuuggcagag       cgc     g
       ||||||||| |  |||||||||||||||||       |||      
3'     cuuauuguc c  uaagaggaaaccgucuc       gcg     u
   uuaa         c gu                 gucgaug   gaaga 
Get sequence
Deep sequencing
151 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr10: 2989450-2989546 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR399a
vvi-MIR399gchr10: 2981247-2981359 [-]
vvi-MIR399hchr10: 2983545-2983634 [+]
vvi-MIR399dchr10: 2988021-2988125 [-]
vvi-MIR399achr10: 2989450-2989546 [+]
vvi-MIR399echr10: 2992220-2992331 [-]
vvi-MIR399fchr10: 2995807-2995913 [-]
Database links

Mature sequence vvi-miR399a

Accession MIMAT0005728
Sequence

67 - 

ugccaaaggagaauugcccug

 - 87

Get sequence
Deep sequencing133 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).