Stem-loop sequence vvi-MIR399a

Accession

MI0006573

Description

Vitis vinifera miR399a stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

--ga         u ug                 -auauca   augga 
    gaauaacag g  auucuccuuuggcagag       cgc     g
    ||||||||| |  |||||||||||||||||       |||      
    cuuauuguc c  uaagaggaaaccgucuc       gcg     u
uuaa         c gu                 gucgaug   gaaga 

Genome context

• Coordinates (Genoscope-20100122): chr10: 2989450-2989546 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from vvi-MIR399a

• vvi-MIR399g: chr10: 2981247-2981359 [-]
• vvi-MIR399h: chr10: 2983545-2983634 [+]
• vvi-MIR399d: chr10: 2988021-2988125 [-]
• vvi-MIR399a: chr10: 2989450-2989546 [+]
• vvi-MIR399e: chr10: 2992220-2992331 [-]
• vvi-MIR399f: chr10: 2995807-2995913 [-]

Database links

• ENTREZGENE: 100272022;MIR399A

Mature sequence vvi-miR399a

• Accession: MIMAT0005728
• Sequence: 67 - ugccaaaggagaauugcccug - 87
• Evidence: experimental; Array [2]

References

1. PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2. PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).