Stem-loop sequence vvi-MIR396d

AccessionMI0006571 (change log)
DescriptionVitis vinifera miR396d stem-loop
Gene family MIPF0000047; MIR396
Literature search

5 open access papers mention vvi-MIR396d
(24 sentences)

Stem-loop
   --cuuu    uc            c          --uuuuu  --    acu       uu 
5'       guau  uuccacagcuuu uugaacugca       ca  gacu   ggugugu  u
         ||||  |||||||||||| ||||||||||       ||  ||||   |||||||   
3'       caua  agggugucgaaa aacuuggcgu       gu  cuga   ucacgua  u
   gacaac    ga            u          ugacaau  ua    aac       ug 
Get sequence
Deep sequencing
6342 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 5253110-5253229 [-]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR396d
vvi-MIR396dchr11: 5253110-5253229 [-]
vvi-MIR396bchr11: 5246790-5246897 [+]
Database links

Mature sequence vvi-miR396d

Accession MIMAT0005726
Sequence

11 - 

uuccacagcuuucuugaacug

 - 31

Get sequence
Deep sequencing5852 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).