Stem-loop sequence vvi-MIR396b

AccessionMI0006570 (change log)
DescriptionVitis vinifera miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

5 open access papers mention vvi-MIR396b
(24 sentences)

Stem-loop
   uccu      c                        uucucccuguuu     ucuccuac 
5'     gccaug uuuuccacagcuuucuugaacuuc            ggugg        g
       |||||| ||||||||||||||||||||||||            |||||         
3'     cgguac aaagggugucgaaagaacuugaag            ucacc        u
   --uu      c                        ------------     uacccauu 
Get sequence
Deep sequencing
11550 reads, 600 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 5246790-5246897 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR396b
vvi-MIR396bchr11: 5246790-5246897 [+]
vvi-MIR396dchr11: 5253110-5253229 [-]
Database links

Mature sequence vvi-miR396b

Accession MIMAT0005725
Sequence

14 - 

uuccacagcuuucuugaacu

 - 33

Get sequence
Deep sequencing7021 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).