Stem-loop sequence vvi-MIR396a

AccessionMI0006569 (change log)
DescriptionVitis vinifera miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

7 open access papers mention vvi-MIR396a
(28 sentences)

Stem-loop
   ucc       cu                  a  a  -    -  u  a   guuug    uc 
5'    ugucaug  uuuccacagcuuucuuga cu cu uuuc ca cu ccu     auga  u
      |||||||  |||||||||||||||||| || || |||| || || |||     ||||   
3'    acgguac  gagggugucgaaagaacu ga ga aaag gu ga gga     uacu  u
   --a       ag                  c  a  u    u  -  -   ----a    uc 
Get sequence
Deep sequencing
7753 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr9: 7372522-7372637 [-]
intergenic
Database links

Mature sequence vvi-miR396a

Accession MIMAT0005724
Sequence

14 - 

uuccacagcuuucuugaacua

 - 34

Get sequence
Deep sequencing7015 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).