Stem-loop sequence vvi-MIR395j

Accession MI0006565
Description Vitis vinifera miR395j stem-loop
Gene family MIPF0000016; MIR395
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--gccc  ua         ug c       c      -  uuc 
      cc  gaguucccc  a cacuuca ugggga uc   u
      ||  |||||||||  | ||||||| |||||| ||   u
      gg  cucaagggg  u gugaagu auccuu ag   u
uacugu  uc         gu u       c      c  uaa 
Get sequence
Genome context
Coordinates (Genoscope-20100122) Overlapping transcripts
chr1: 6553026-6553111 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR395j
vvi-MIR395j chr1: 6553026-6553111 [+]
vvi-MIR395m chr1: 6557811-6557902 [+]
vvi-MIR395l chr1: 6559098-6559184 [+]
vvi-MIR395i chr1: 6562642-6562727 [+]
Database links

Mature sequence vvi-miR395j

Accession MIMAT0005720
Sequence

56 - 

cugaaguguuugggggaacuc

 - 76

Get sequence
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).