Stem-loop sequence vvi-MIR166e

AccessionMI0006511 (change log)
DescriptionVitis vinifera miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

8 open access papers mention vvi-MIR166e
(16 sentences)

Stem-loop
   --   uu   a        uu      cu   g         uagau        ugcguguaauugugaaugggugaucgucuc 
5'   gug  uug ggggaaug  gucugg  cga gacaccaac     cuaugauc                              u
     |||  ||| ||||||||  ||||||  ||| |||||||||     ||||||||                              c
3'   uau  aac ccccuuac  cggacc  gcu cugugguug     gguacuag                              a
   gu   uu   c        uu      ag   g         -----        uuucuagugaguuuuagagaggaaguuuug 
Get sequence
Deep sequencing
2314378 reads, 1.54e+05 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr2: 2255722-2255887 [+]
intergenic
Database links

Mature sequence vvi-miR166e

Accession MIMAT0005666
Sequence

135 - 

ucggaccaggcuucauucccc

 - 155

Get sequence
Deep sequencing2309947 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).