Stem-loop sequence vvi-MIR166d

AccessionMI0006510 (change log)
DescriptionVitis vinifera miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

8 open access papers mention vvi-MIR166d
(15 sentences)

Stem-loop
   --cugcu         u  uu      cu     c   c   - aucuuugauugauucaaauacuuugaucagcuucaa 
5'        uugagggga ug  gucugg  cgagg cac aac c                                    c
          ||||||||| ||  ||||||  ||||| ||| ||| |                                    c
3'        aacuccccu ac  cggacc  gcucc gug uug g                                    c
   cgucacu         u  uu      ag     c   a   u uauuagucucccaccuuaacuuaacuuccucuucua 
Get sequence
Deep sequencing
2424292 reads, 1.62e+05 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr16: 21405216-21405375 [-]
intergenic
Database links

Mature sequence vvi-miR166d

Accession MIMAT0005665
Sequence

129 - 

ucggaccaggcuucauucccc

 - 149

Get sequence
Deep sequencing2420588 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).