Stem-loop sequence vvi-MIR160b

Accession MI0006497
Description Vitis vinifera miR160b stem-loop
Gene family MIPF0000032; MIR160
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-160_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, mir-160 is a microRNA that has been predicted or experimentally confirmed in a range of plant species including Arabidopsis thaliana (mouse-ear cress) and Oryza sativa (rice). miR-160 is predicted to bind complementary sites in the untranslated regions of auxin response factor genes to regulate their expression. The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 5' arm of the hairpin. Specifically, 3 of A. thaliana's 23 auxin-response factor genes are thought to be post-transcriptionally regulated by mir-160. When one of these targets (ARF17) is manipulated to become miRNA-resistant, several developmental defects can be observed in the host plant. This experiment has been repeated with another mir-160 target, ARF10, and results highlighted a regulatory role in post-embryonic development and seed germination.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
---aaua    u    c         ga      uc  a    c       ag 
       uugu cugc uggcucccu  augcca  ua gaag uuguuaa  a
       |||| |||| |||||||||  ||||||  || |||| |||||||   
       agcg gacg acugagggg  uacggu  au cuuc aacaguu  g
uucacaa    -    a         ag      uu  c    c       gu 
Get sequence
Genome context
Coordinates (Genoscope-20100122) Overlapping transcripts
chr10: 1222379-1222482 [+]
intergenic
Database links

Mature sequence vvi-miR160b

Accession MIMAT0005652
Sequence

11 - 

ugccuggcucccugaaugccauc

 - 33

Get sequence
Evidence experimental; Array [2], Solexa [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).