Stem-loop sequence vvi-MIR156e

AccessionMI0006489
DescriptionVitis vinifera miR156e stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --  a   ua         --  a          u  u   ucuu   uu     aa 
5'   gu ugg  ggugacaga  gg gagugagcac ca ggu    uuc  gcaug  g
     || |||  |||||||||  || |||||||||| || |||    |||  |||||  u
3'   cg acu  ccacugucu  cc cucauucgug gu ucg    aag  cguau  u
   ua  a   cc         au  -          u  c   ----   uu     cu 
Get sequence
Deep sequencing
23 reads, 52 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Genoscope-20100122) Overlapping transcripts
chr11: 1504194-1504301 [-]
intergenic
Database links

Mature sequence vvi-miR156e

Accession MIMAT0005644
Sequence

11 - 

ugacagaggagagugagcac

 - 30

Get sequence
Deep sequencing19 reads, 3 experiments
Evidence by similarity; MI0000183

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).