Stem-loop sequence vvi-MIR156d

AccessionMI0006488
DescriptionVitis vinifera miR156d stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --agaga  ga         -     -       au  a    auuu     a 
5'        ga  cugacagaa gagag ugagcac  gc ggca    guaua g
          ||  ||||||||| ||||| |||||||  || ||||    |||||  
3'        cu  gacugucuu cucuc acucgug  ug ccgu    cauau g
   ucgugga  uc         u     c       cg  g    -auc     g 
Get sequence
Deep sequencing
2994 reads, 6.15e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Genoscope-20100122) Overlapping transcripts
chr11: 7623217-7623319 [-]
intergenic
Database links

Mature sequence vvi-miR156d

Accession MIMAT0005643
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Deep sequencing2529 reads, 3 experiments
Evidence experimental; Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).