Stem-loop sequence bna-MIR156c

AccessionMI0006484 (change log)
DescriptionBrassica napus miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

13 open access papers mention bna-MIR156c
(203 sentences)

Stem-loop
           -ugca   u           -           u     --u  c    aaguacaaggauauaaggaaauu 
5' gggaguga     ggu guugacagaag auagagagcac aagga   ga augc                       c
   ||||||||     ||| ||||||||||| ||||||||||| |||||   || ||||                        
3' uccuuauu     cca uaacugucuuc uaucucucgug uuucu   uu uacg                       a
           uauua   -           a           u     cau  c    uccgagaaaaaaggagagaaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BH950400: 212-366 [-]
intergenic
Database links

Mature sequence bna-miR156c

Accession MIMAT0005639
Sequence

18 - 

uugacagaagauagagagcac

 - 38

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).