Stem-loop sequence bna-MIR1140

AccessionMI0006482 (change log)
Previous IDsbna-MIR1140a
DescriptionBrassica napus miR1140 stem-loop
Gene family MIPF0001568; MIR1140
Literature search

4 open access papers mention bna-MIR1140
(7 sentences)

Stem-loop
   cuca   uuuua               c                 u      cuuucuaaagucuucaaaauuuagu 
5'     auc     uauggcuccgauugg uuuaggcuguuguggcu ugacuu                         u
       |||     ||||||||||||||| ||||||||||||||||| ||||||                         u
3'     uag     guaccgaggcuaacc aaauccgacaacaccga acugaa                         u
   ---g   ---ug               -                 c      aauuuuuuuaaauugcacuaacacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189528: 128989-129138 [+]
intergenic
Database links

Mature sequence bna-miR1140

Accession MIMAT0005637
Previous IDsbna-miR1140a
Sequence

120 - 

acagccuaaaccaaucggagc

 - 140

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2