Stem-loop sequence bna-MIR156b

AccessionMI0006481 (change log)
DescriptionBrassica napus miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

13 open access papers mention bna-MIR156b
(273 sentences)

Stem-loop
        uu     ------u    c    u  u        -           u     --u        a  a auauguauguaucaucacaccgccuguggaugau 
5' uaggu  gagag       gaug uggu gu gacagaag auagagagcac aagga   gacaugca gu c                                  u
   |||||  |||||       |||| |||| || |||||||| ||||||||||| |||||   |||||||| || |                                   
3' aucca  cuuuc       uuau acca ca cugucuuc uaucucucgug uuucu   cuguacgu cg g                                  a
        uu     uucuucu    u    c  -        a           c     cau        c  a agagagagagagaaaacuuaaccaaaauaaaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189250: 143274-143481 [-]
intergenic
Database links

Mature sequence bna-miR156b

Accession MIMAT0005636
Sequence

25 - 

uugacagaagauagagagcac

 - 45

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).