Stem-loop sequence bna-MIR159

AccessionMI0006480 (change log)
DescriptionBrassica napus miR159 stem-loop
Gene family MIPF0000010; MIR159
Literature search

9 open access papers mention bna-MIR159
(51 sentences)

Stem-loop
   -            a         c      -uu    ------      aga      g  a  c    a uc     -    cu       aua 
5'  guagggcuccuu uaguucaaa gagagu   agca      ggguaa   aaagcu cu ag uaug a  ccaua agcc  aauccuu   u
    |||||||||||| ||||||||| ||||||   ||||      ||||||   |||||| || || |||| |  ||||| ||||  |||||||   a
3'  caucucgaggga guuagguuu uucuca   ucgu      cccguu   uuucga ga uc auac u  gguau uugg  uuaggaa   u
   a            a         c      uuu    uaauuu      caa      g  c  u    a uc     a    -u       aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189598: 83537-83719 [-]
intergenic
EM:EX039355: 186-368 [+]
intergenic
EM:EX072729: 247-429 [+]
intergenic
EM:EX073973: 245-427 [+]
intergenic
Database links

Mature sequence bna-miR159

Accession MIMAT0005635
Sequence

161 - 

uuuggauugaagggagcucua

 - 181

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2